LoginSite MapOnline SupportContactPrivacy PolicyIP Policy
Site Search
 
View Shopping Cart

Books & Journals/Journal of Forensic Sciences/Citation Page/

Volume 45, Issue 5 (September 2000)

ISSN: 0022-1198
Published Online: 1 September 2000
Page Count: 2

Click here to download this paper now for $25

View License Agreement

Mitochondrial DNA HVI and HVII variation in a North-East Spanish population
Martinez-Jarreta, B
Department of Forensic Science, Faculty of Medicine. University of Zaragoza, Zaragoza, Spain.

Prades, A
Department of Forensic Science, Faculty of Medicine. University of Zaragoza, Zaragoza, Spain.

Calafell, F
Evolutionary Biology Unit. Health and Life Sciences School, Universitat Pompeu Fabra, Doctor Aiguader 80, 08003 Barcelona, Spain.

Budowle, B
Forensic Science and Training Center, FBI Academy, Quantico, Virginia 22135.


Abstract
Mt DNA Amplifications and Sequencing--HVI was amplifiedby means of a semi-nested PCR strategy. In the first round ofamplification, primers L15996 (5'CACCATTAGCACCCAAAGCT3')and H408 (5'CTGTTAAAAGTGATACCGCCA 3')were used, and a fragment of 1021 bp (i.e., the whole control region)was obtained. In the second round of PCR, a fragment of 443bp spanning the HVI segment was amplified by means of primersL15996 and H16401 (5' TGATTTCACGGAGGATGGTG 3').HVII was amplified in two overlapping fragments, namely HVIIA(278 bp) and HVII-B (277 bp). The former fragment was amplifiedwith primers L047 (5'-CTCACGGGAGCTCTCCATGC-3')and H285 (5'GGGGTTTGGTGGAAATTTT TTTG-3'), and thelatter fragment with primers L172 (5'-ATTATTTATCGCACCTACGT-3') and H408. The PCR products were purified using MICROSPINHR S-300 (Pharmacia, Uppsala, Sweden) before cyclesequencing. The sequence reactions were carried out using thePCR Fentomol Sequencing Kit (Promega, Madison) and fluorestcently labeled sequencing primers. The sequence products weredenatured with deionizide formamide and separated in a 6% PAGEgel and analyzed in an A.L.F. automatic sequencer (Pharmacia,Uppsala, Sweden). Both the L-strand and the H-strand weresequenced and the base calling was confirmed when the twostrands showed clearly complementary peaks. The mtDNA haplotypesare recorded based on their differences from a standardmtDNA reference sequence (2).

Keywords:
Aragon, D7S8, DNA typing, forensic science, GC, GYPA, HBGG, HLA-DQA1, LDLR, population genetics, short tandem repeats, Zaragoza

Paper ID: JFS4551162

ASTM International is a member of CrossRef.
Author Martinez-Jarreta B, Prades A, Calafell F, Budowle B Title Mitochondrial DNA HVI and HVII variation in a North-East Spanish population Symposium , Committee on